piRNA Targets

Select organism
Gene Symbol
Trans ID
  items per page
  Total page: 216  Total amount: 3240
first page | previous page | next page | last page
piRNA name piRNA sequence Target gene Target mRNA Mechanism Target site Verified PubMed
piR-mmu-213655TGAGATCCAACTGTAAGGCATTTTCTCAHmmrNM_013552cleavagemm9 chr11:40515856-40515876:-n25582079
piR-mmu-251116TAAGATTCAACTGTAAGGCATTTTCTTAATHmmrNM_013552cleavagemm9 chr11:40515856-40515876:-n25582079
piR-mmu-425301TAAGATCCAACTGTAAGGCATTTTCTCAATTHmmrNM_013552cleavagemm9 chr11:40515856-40515876:-n25582079
piR-mmu-425522TAAGATTCAACTGTAAGGCATTTTCTTAHmmrNM_013552cleavagemm9 chr11:40515856-40515876:-n25582079
piR-mmu-515483TGAGATCCAACTGTAAGGCATTTTCTCAACHmmrNM_013552cleavagemm9 chr11:40515856-40515876:-n25582079
piR-mmu-515484TGAGATCCAACTGTAAGGCATTTTCTCAATHmmrNM_013552cleavagemm9 chr11:40515856-40515876:-n25582079
piR-mmu-515487TGAGATCCAGCTGTAAGGCATTTTTTTCHmmrNM_013552cleavagemm9 chr11:40515856-40515876:-n25582079
piR-mmu-516722TGAGCTCCAGCTGTAAGGCATATTCTTAATHmmrNM_013552cleavagemm9 chr11:40515856-40515876:-n25582079
piR-mmu-112427TGAGATCCAACTGTAAGGCATTTTCTCAAHmmrNM_013552cleavagemm9 chr11:40515856-40515876:-n25582079
piR-mmu-171236TTTTATCACAGCAACAGAAAGGAAACTAFam206aNM_001081420cleavagemm9 chr4:56821998-56822018:+n25582079
piR-mmu-81732TTTTATCACAGCAACAGAAAGGAAACTAGGAFam206aNM_001081420cleavagemm9 chr4:56821998-56822018:+n25582079
piR-mmu-381481CTTTATCACAGCAACAGACAGTAACTCAGFam206aNM_001081420cleavagemm9 chr4:56821998-56822018:+n25582079
piR-mmu-381482CTTTATCACAGCAACAGACAGTAACTCAGAFam206aNM_001081420cleavagemm9 chr4:56821998-56822018:+n25582079
piR-mmu-100381TTTTATCACAGCAACAGAAAGGAAACTAGFam206aNM_001081420cleavagemm9 chr4:56821998-56822018:+n25582079
piR-mmu-103649TTTTATCACAGCAACAGAAAGGAAACTAGTFam206aNM_001081420cleavagemm9 chr4:56821998-56822018:+n25582079
  Total page: 216  Total amount: 3240
first page | previous page | next page | last page