piRNA



Detailed information of piRNA piR-hsa-7193
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-7193
Organism:Human
Sequence:TCGCCGTGATCGTATAGTGGTTAGTACTCTG
Length:31
Accession: DQ576872
Aliases:piR-44984 PIR37983
Number of Papers:1
Number of Methods:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
Location in hg38
7 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr1:146038041-146038072:+tRNA tRNA tRNA-His-CAY_;
Location 2chr1:148281362-148281393:+tRNA tRNA tRNA-His-CAY_;
Location 3chr1:148302776-148302807:-tRNA tRNA tRNA-His-CAY_;
Location 4chr15:45198648-45198679:-SHF NM_138356; tRNA tRNA tRNA-His-CAY_;
Location 5chr15:45200455-45200486:-SHF NM_138356; tRNA tRNA tRNA-His-CAY_;
Location 6chr15:45201148-45201179:+SHF NM_138356; tRNA tRNA tRNA-His-CAY_;
Location 7chr2:224934103-224934134:+DOCK10 NM_014689; DOCK10 NM_001290263; DOCK10 NM_001363762; tRNA tRNA tRNA-His-CAY_;
To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
ID in articleCancerSubtypeExpressionFunctionPubMed
piR-4987breast cancerup-regulated FC 7.4623229900
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 23229900
Huang G, Hu H, Xue X, Shen S, Gao E, Guo G, Shen X, Zhang X.
Altered expression of piRNAs and their relation with clinicopathologic features of breast cancer.
Clin Transl Oncol. 2013 Jul;15(7):563-8. doi: 10.1007/s12094-012-0966-0. Epub 2012 Nov 15.