piRNA



Detailed information of piRNA piR-hsa-28527
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-28527
Organism:Human
Sequence:GGTTCCATGGTGTAATGGTTAGCACTCTG
Length:29
Accession: DQ598312
Aliases:piR-36378 PIR59423
Number of Papers:1
Number of Methods:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
Location in hg38
13 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr17:8119751-8119780:+tRNA tRNA tRNA-Gln-CAG;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
ID in articleCancerSubtypeExpressionFunctionPubMed
piR-20582breast cancerup-regulated FC 3.2423229900
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 23229900
Huang G, Hu H, Xue X, Shen S, Gao E, Guo G, Shen X, Zhang X.
Altered expression of piRNAs and their relation with clinicopathologic features of breast cancer.
Clin Transl Oncol. 2013 Jul;15(7):563-8. doi: 10.1007/s12094-012-0966-0. Epub 2012 Nov 15.