piRNA



Detailed information of piRNA piR-hsa-28190
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-28190
Organism:Human
Sequence:GGCCGTGATCGTATAGTGGTTAGTACTCTG
Length:30
Accession: DQ597975
Aliases:piR-36041 PIR59086
Number of Papers:2
Number of Methods:2
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
167GSM15845217525818294small RNAadult ovary
168GSM158452217925818294small RNAadult ovary
169GSM158452323525818294oxidized small RNAadult ovary
170GSM158452411925818294oxidized small RNAadult ovary
171GSM15845251625818294small RNAovary from 1st trimester embryos
172GSM15845261025818294small RNAovary from 1st trimester embryos
173GSM1584527925818294oxidized small RNAovary from 1st trimester embryos
175GSM158452912525818294small RNAovary from 2nd trimester embryos
176GSM158453098425818294small RNAovary from 2nd trimester embryos
177GSM158453110725818294oxidized small RNAovary from 2nd trimester embryos
178GSM1584532925818294oxidized small RNAovary from 2nd trimester embryos
Location in hg38
1 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr11:109603196-109603226:+tRNA tRNA tRNA-His-CAY_;
To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
ID in articleCancerSubtypeExpressionFunctionPubMed
piR-20365breast cancerup-regulated FC 5.0823229900
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 25818294
Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Cell Rep. 2015 Mar 31;10(12):2069-82.
PubMed: 23229900
Huang G, Hu H, Xue X, Shen S, Gao E, Guo G, Shen X, Zhang X.
Altered expression of piRNAs and their relation with clinicopathologic features of breast cancer.
Clin Transl Oncol. 2013 Jul;15(7):563-8. doi: 10.1007/s12094-012-0966-0. Epub 2012 Nov 15.