piRNA



Detailed information of piRNA piR-hsa-27616
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-27616
Organism:Human
Sequence:GCCCGGATGATCCTCAGTGGTCTGGGGTGC
Length:30
Accession: DQ597341
Aliases:piR-35407 PIR58452
Number of Papers:1
Number of Methods:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
Location in hg38
1 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr19:45478657-45478687:-tRNA tRNA tRNA-SeC(e)-TGA;
To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
ID in articleCancerSubtypeExpressionFunctionPubMed
piR-35407Breast cancerdown-regulated25313140
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 25313140
Hashim A, Rizzo F, Marchese G, Ravo M, Tarallo R, Nassa G, Giurato G, Santamaria G, Cordella A, Cantarella C, Weisz A.
RNA sequencing identifies specific PIWI-interacting small non-coding RNA expression patterns in breast cancer
Oncotarget. 2014 Oct 30;5(20):9901-10.