piRNA



Detailed information of piRNA piR-hsa-26527
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-26527
Organism:Human
Sequence:GACCAATGATGAGATTGGAGGGTGTCTGAAT
Length:31
Accession: DQ596311
Aliases:piR-34377 PIR57422
Number of Papers:1
Number of Methods:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
Location in hg38
1 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr14:100943452-100943483:+MEG8 NR_146000; SNORD113-8 NR_003236; LINE L1 L1ME5;
To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
ID in articleCancerSubtypeExpressionFunctionPubMed
DQ596311Bladder cancerdown-regulated FC 5.325305452
piR-34377Breast cancerdown-regulated25313140
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 25305452
Chu H, Hui G, Yuan L, Shi D, Wang Y, Du M, Zhong D, Ma L, Tong N, Qin C, Yin C, Zhang Z, Wang M.
Identification of novel piRNAs in bladder cancer
Cancer Lett. 2015 Jan 28;356(2 Pt B):561-7. doi: 10.1016/j.canlet.2014.10.004. Epub 2014 Oct 8.
PubMed: 25313140
Hashim A, Rizzo F, Marchese G, Ravo M, Tarallo R, Nassa G, Giurato G, Santamaria G, Cordella A, Cantarella C, Weisz A.
RNA sequencing identifies specific PIWI-interacting small non-coding RNA expression patterns in breast cancer
Oncotarget. 2014 Oct 30;5(20):9901-10.