piRNA



Detailed information of piRNA piR-hsa-1519
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-1519
Organism:Human
Sequence:AGGATGCTTGATCCTGAAGGGTTAGCAGCA
Length:30
Accession: DQ571182
Aliases:piR-31294 PIR32293
Number of Papers:1
Number of Methods:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
Location in hg38
1 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr3:15044820-15044850:+NR2C2 NM_003298; NR2C2 NM_001291694; MRPS25 NR_135246; MRPS25 NR_135247;
To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
ID in articleCancerSubtypeExpressionFunctionPubMed
piR-932Breast cancerCD44+/CD24−up-regulatedmay be a positive regulator through promoting the methylation of Latexin23992744
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 23992744
Zhang H, Ren Y, Xu H, Pang D, Duan C, Liu C.
The expression of stem cell protein Piwil2 and piR-932 in breast cancer.
Surg Oncol. 2013 Dec;22(4):217-23. doi: 10.1016/j.suronc.2013.07.001. Epub 2013 Aug 27.