piRNA



Detailed information of piRNA piR-hsa-1245
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-1245
Organism:Human
Sequence:AGCCCTGATGATGCCCACTCCTGAGC
Length:26
Accession: DQ570994
Aliases:piR-31106 PIR32105
Number of Papers:3
Number of Methods:2
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
3N/A422313525small RNAepididymis
167GSM1584521225818294small RNAadult ovary
168GSM1584522125818294small RNAadult ovary
171GSM1584525725818294small RNAovary from 1st trimester embryos
172GSM1584526925818294small RNAovary from 1st trimester embryos
173GSM1584527225818294oxidized small RNAovary from 1st trimester embryos
175GSM1584529825818294small RNAovary from 2nd trimester embryos
176GSM15845302125818294small RNAovary from 2nd trimester embryos
177GSM1584531125818294oxidized small RNAovary from 2nd trimester embryos
Location in hg38
1 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr9:137013749-137013775:-ABCA2 NM_001606; ABCA2 NM_212533;
To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
ID in articleCancerSubtypeExpressionFunctionPubMed
piR-31106Breast cancerup-regulated25313140
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 22313525
Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.
Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Gene. 2012 Apr 15;497(2):330-5.
PubMed: 25818294
Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Cell Rep. 2015 Mar 31;10(12):2069-82.
PubMed: 25313140
Hashim A, Rizzo F, Marchese G, Ravo M, Tarallo R, Nassa G, Giurato G, Santamaria G, Cordella A, Cantarella C, Weisz A.
RNA sequencing identifies specific PIWI-interacting small non-coding RNA expression patterns in breast cancer
Oncotarget. 2014 Oct 30;5(20):9901-10.