piRNA



Detailed information of piRNA piR-hsa-9
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-9
Organism:Human
Sequence:TGGGAACGAGAAGACACTCATGGAGGAGTC
Length:30
Accession: DQ588378
Aliases:piR-55490 PIR192559 PIR192289 PIR192355 PIR192384 PIR192429 PIR192460 PIR192499 PIR192533 PIR192599 PIR192632 PIR192667 PIR192699 PIR192759 PIR192792 PIR192819 PIR192849 PIR192889 PIR192950 PIR193005 PIR193057 PIR193094 PIR193140 PIR49489
Number of Papers:4
Number of Methods:2
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
2N/AN/A16751777small RNAtestis
3N/A1022313525small RNAepididymis
175GSM1584529425818294small RNAovary from 2nd trimester embryos
176GSM15845301025818294small RNAovary from 2nd trimester embryos
177GSM15845317125818294oxidized small RNAovary from 2nd trimester embryos
178GSM15845321225818294oxidized small RNAovary from 2nd trimester embryos
Location in hg38
23 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr15:101757178-101757208:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
No record.
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.
PubMed: 22313525
Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.
Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Gene. 2012 Apr 15;497(2):330-5.
PubMed: 25818294
Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Cell Rep. 2015 Mar 31;10(12):2069-82.