piRNA



Detailed information of piRNA piR-hsa-9
Go to: General Datasets Location Reference
General Information
Name:piR-hsa-9
Organism:Human
Sequence:TGGGAACGAGAAGACACTCATGGAGGAGTC
Length:30
Accession: DQ588378
Aliases:piR-55490 PIR192559 PIR192289 PIR192355 PIR192384 PIR192429 PIR192460 PIR192499 PIR192533 PIR192599 PIR192632 PIR192667 PIR192699 PIR192759 PIR192792 PIR192819 PIR192849 PIR192889 PIR192950 PIR193005 PIR193057 PIR193094 PIR193140 PIR49489
Number of Papers:3
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
2N/AN/A16751777small RNAtestis
3N/A1022313525small RNAepididymis
Location in hg19
23 best hit(s) with 0 mismatch(es) in hg19. RefSeq Gene RepeatMasker
Location 1chr15:100340382-100340412:-DNM1P46 NR_003260;
Location 2chr15:102292903-102292933:+
Location 3chr15:102293546-102293576:+
Location 4chr15:102293890-102293920:+
Location 5chr15:102294416-102294446:+
Location 6chr15:102294851-102294881:+
Location 7chr15:102295377-102295407:+
Location 8chr15:102295903-102295933:+
Location 9chr15:102296238-102296268:+
Location 10chr15:102296855-102296885:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.
PubMed: 22313525
Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.
Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Gene. 2012 Apr 15;497(2):330-5.