piRNA



Detailed information of piRNA piR-hsa-8
Go to: General Datasets Location Reference
General Information
Name:piR-hsa-8
Organism:Human
Sequence:TGGGAACGAGAAGACACTCATGGAGGCGTC
Length:30
Accession:
Aliases:PIR192558 PIR192862 PIR192284 PIR192291 PIR192300 PIR192317 PIR192324 PIR192336 PIR192345 PIR192357 PIR192373 PIR192382 PIR192400 PIR192409 PIR192422 PIR192428 PIR192451 PIR192461 PIR192479 PIR192488 PIR192498 PIR192511 PIR192522 PIR192532 PIR192549 PIR192575 PIR192591 PIR192600 PIR192622 PIR192633 PIR192644 PIR192658 PIR192665 PIR192677 PIR192691 PIR192701 PIR192719 PIR192748 PIR192761 PIR192783 PIR192793 PIR192809 PIR192817 PIR192837 PIR192848 PIR192879 PIR192891 PIR192908 PIR192940 PIR192951 PIR192974 PIR192992 PIR193003 PIR193019 PIR193029 PIR193044 PIR193058 PIR193084 PIR193093 PIR193108 PIR193120 PIR193134 PIR193141
Number of Papers:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
Location in hg19
64 best hit(s) with 1 mismatch(es) in hg19. RefSeq Gene RepeatMasker
Location 1chr15:100340382-100340412:-DNM1P46 NR_003260;
Location 2chr15:102292812-102292842:+
Location 3chr15:102292903-102292933:+
Location 4chr15:102293091-102293121:+
Location 5chr15:102293182-102293212:+
Location 6chr15:102293273-102293303:+
Location 7chr15:102293364-102293394:+
Location 8chr15:102293455-102293485:+
Location 9chr15:102293546-102293576:+
Location 10chr15:102293799-102293829:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.