piRNA



Detailed information of piRNA piR-hsa-7
Go to: General Datasets Location Reference
General Information
Name:piR-hsa-7
Organism:Human
Sequence:TGGAAACGAGAAGACACTCATGGAGGAGT
Length:29
Accession:
Aliases:PIR192557 PIR192290 PIR192356 PIR192383 PIR192430 PIR192462 PIR192497 PIR192534 PIR192601 PIR192631 PIR192666 PIR192700 PIR192760 PIR192794 PIR192818 PIR192850 PIR192890 PIR192952 PIR193004 PIR193059 PIR193095 PIR193142
Number of Papers:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
Location in hg19
23 best hit(s) with 1 mismatch(es) in hg19. RefSeq Gene RepeatMasker
Location 1chr15:100340383-100340412:-DNM1P46 NR_003260;
Location 2chr15:102292903-102292932:+
Location 3chr15:102293546-102293575:+
Location 4chr15:102293890-102293919:+
Location 5chr15:102294416-102294445:+
Location 6chr15:102294851-102294880:+
Location 7chr15:102295377-102295406:+
Location 8chr15:102295903-102295932:+
Location 9chr15:102296238-102296267:+
Location 10chr15:102296855-102296884:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.