piRNA



Detailed information of piRNA piR-hsa-7
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-7
Organism:Human
Sequence:TGGAAACGAGAAGACACTCATGGAGGAGT
Length:29
Accession:
Aliases:PIR192557 PIR192290 PIR192356 PIR192383 PIR192430 PIR192462 PIR192497 PIR192534 PIR192601 PIR192631 PIR192666 PIR192700 PIR192760 PIR192794 PIR192818 PIR192850 PIR192890 PIR192952 PIR193004 PIR193059 PIR193095 PIR193142
Number of Papers:1
Number of Methods:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
Location in hg38
23 best hit(s) with 1 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr15:101761790-101761819:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
No record.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.