piRNA



Detailed information of piRNA piR-hsa-6
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-6
Organism:Human
Sequence:TGTCCAACCTGCACTCGCGTGGGAA
Length:25
Accession:
Aliases:PIR192556 PIR192278 PIR192292 PIR192311 PIR192342 PIR192354 PIR192381 PIR192417 PIR192459 PIR192486 PIR192521 PIR192544 PIR192584 PIR192588 PIR192620 PIR192664 PIR192686 PIR192698 PIR192714 PIR192728 PIR192738 PIR192758 PIR192777 PIR192781 PIR192816 PIR192831 PIR192847 PIR192874 PIR192878 PIR192904 PIR192919 PIR192929 PIR192949 PIR192968 PIR192972 PIR192986 PIR193002 PIR193028 PIR193040 PIR193092 PIR193129 PIR193153
Number of Papers:2
Number of Methods:2
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
169GSM1584523125818294oxidized small RNAadult ovary
177GSM1584531125818294oxidized small RNAovary from 2nd trimester embryos
Location in hg38
43 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr15:101757932-101757957:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
No record.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.
PubMed: 25818294
Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Cell Rep. 2015 Mar 31;10(12):2069-82.