piRNA



Detailed information of piRNA piR-hsa-5
Go to: General Datasets Location Reference
General Information
Name:piR-hsa-5
Organism:Human
Sequence:TCATCTTCTCAGAGCTGCTGTCCAACCTGC
Length:30
Accession: DQ573815
Aliases:piR-41927 PIR192555 PIR192310 PIR192341 PIR192353 PIR192380 PIR192416 PIR192485 PIR192520 PIR192583 PIR192587 PIR192619 PIR192663 PIR192685 PIR192697 PIR192727 PIR192757 PIR192776 PIR192780 PIR192815 PIR192846 PIR192873 PIR192877 PIR192918 PIR192948 PIR192967 PIR192971 PIR193001 PIR193027 PIR193039 PIR193056 PIR193091 PIR193128 PIR193163 PIR34926
Number of Papers:3
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
2N/AN/A16751777small RNAtestis
177GSM1584531225818294oxidized small RNAovary from 2nd trimester embryos
Location in hg19
34 best hit(s) with 0 mismatch(es) in hg19. RefSeq Gene RepeatMasker
Location 1chr15:100340010-100340040:-DNM1P46 NR_003260;
Location 2chr15:102293145-102293175:+
Location 3chr15:102293418-102293448:+
Location 4chr15:102293509-102293539:+
Location 5chr15:102293853-102293883:+
Location 6chr15:102294288-102294318:+
Location 7chr15:102295249-102295279:+
Location 8chr15:102295775-102295805:+
Location 9chr15:102296201-102296231:+
Location 10chr15:102296636-102296666:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.
PubMed: 25818294
Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Cell Rep. 2015 Mar 31;10(12):2069-82.