piRNA



Detailed information of piRNA piR-hsa-4
Go to: General Datasets Location Reference
General Information
Name:piR-hsa-4
Organism:Human
Sequence:ACCAAGGACTTCATCTTCTCAGAGCTGCTGT
Length:31
Accession:
Aliases:PIR192554 PIR192871 PIR192872 PIR192276 PIR192288 PIR192299 PIR192309 PIR192330 PIR192340 PIR192352 PIR192379 PIR192415 PIR192427 PIR192449 PIR192483 PIR192484 PIR192496 PIR192518 PIR192519 PIR192531 PIR192581 PIR192582 PIR192586 PIR192598 PIR192617 PIR192618 PIR192630 PIR192652 PIR192662 PIR192684 PIR192696 PIR192726 PIR192746 PIR192756 PIR192774 PIR192775 PIR192779 PIR192791 PIR192804 PIR192814 PIR192835 PIR192845 PIR192876 PIR192888 PIR192907 PIR192917 PIR192937 PIR192947 PIR192965 PIR192966 PIR192970 PIR192990 PIR193000 PIR193026 PIR193038 PIR193055 PIR193080 PIR193090 PIR193117 PIR193127 PIR193139 PIR193162
Number of Papers:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
Location in hg19
64 best hit(s) with 1 mismatch(es) in hg19. RefSeq Gene RepeatMasker
Location 1chr15:79042412-79042443:-
Location 2chr15:100340019-100340050:-DNM1P46 NR_003260;
Location 3chr15:102292668-102292699:+
Location 4chr15:102292856-102292887:+
Location 5chr15:102293044-102293075:+
Location 6chr15:102293135-102293166:+
Location 7chr15:102293317-102293348:+
Location 8chr15:102293408-102293439:+
Location 9chr15:102293499-102293530:+
Location 10chr15:102293843-102293874:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.