piRNA



Detailed information of piRNA piR-hsa-2
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-2
Organism:Human
Sequence:ACGCCTCCACGTAGTGTCTT
Length:20
Accession:
Aliases:PIR192552 PIR192869 PIR192286 PIR192298 PIR192307 PIR192320 PIR192328 PIR192338 PIR192350 PIR192377 PIR192405 PIR192414 PIR192425 PIR192448 PIR192458 PIR192482 PIR192494 PIR192516 PIR192529 PIR192579 PIR192597 PIR192615 PIR192628 PIR192651 PIR192660 PIR192682 PIR192694 PIR192716 PIR192725 PIR192745 PIR192755 PIR192789 PIR192812 PIR192834 PIR192843 PIR192887 PIR192906 PIR192915 PIR192935 PIR192946 PIR192980 PIR192989 PIR192998 PIR193025 PIR193036 PIR193048 PIR193054 PIR193078 PIR193089 PIR193116 PIR193126 PIR193137
Number of Papers:1
Number of Methods:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
Location in hg38
No loci found in hg38! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
No record.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.