piRNA



Detailed information of piRNA piR-hsa-15
Go to: General Datasets Location Reference
General Information
Name:piR-hsa-15
Organism:Human
Sequence:TCTTCTCGGAGCTGCTGTCCAACCTGTAC
Length:29
Accession: DQ578298
Aliases:piR-46410 PIR192565 PIR192363 PIR192391 PIR192437 PIR192467 PIR192504 PIR192541 PIR192607 PIR192638 PIR192707 PIR192731 PIR192768 PIR192801 PIR192824 PIR192856 PIR192898 PIR192922 PIR192957 PIR193012 PIR193066 PIR193100 PIR193150 PIR193160 PIR39409
Number of Papers:4
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
2N/AN/A16751777small RNAtestis
3N/A622313525small RNAepididymis
167GSM1584521125818294small RNAadult ovary
169GSM1584523225818294oxidized small RNAadult ovary
170GSM1584524225818294oxidized small RNAadult ovary
175GSM1584529125818294small RNAovary from 2nd trimester embryos
177GSM15845311825818294oxidized small RNAovary from 2nd trimester embryos
178GSM1584532125818294oxidized small RNAovary from 2nd trimester embryos
Location in hg19
27 best hit(s) with 0 mismatch(es) in hg19. RefSeq Gene RepeatMasker
Location 1chr15:30393336-30393365:-
Location 2chr15:30688286-30688315:+
Location 3chr15:30862333-30862362:-
Location 4chr15:32729635-32729664:+
Location 5chr15:102293668-102293697:+
Location 6chr15:102294012-102294041:+
Location 7chr15:102294538-102294567:+
Location 8chr15:102294973-102295002:+
Location 9chr15:102295499-102295528:+
Location 10chr15:102296025-102296054:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.
PubMed: 22313525
Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY.
Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis.
Gene. 2012 Apr 15;497(2):330-5.
PubMed: 25818294
Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Cell Rep. 2015 Mar 31;10(12):2069-82.