piRNA



Detailed information of piRNA piR-hsa-14
Go to: General Datasets Location Reference
General Information
Name:piR-hsa-14
Organism:Human
Sequence:TCTTCTCGGAGCTGCTGTCCAACCTGTACT
Length:30
Accession: DQ578299
Aliases:piR-46411 PIR192564 PIR192362 PIR192389 PIR192436 PIR192468 PIR192506 PIR192540 PIR192606 PIR192639 PIR192708 PIR192730 PIR192766 PIR192800 PIR192823 PIR192857 PIR192896 PIR192923 PIR192958 PIR193010 PIR193067 PIR193102 PIR193149 PIR193158 PIR39410
Number of Papers:3
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
2N/AN/A16751777small RNAtestis
169GSM1584523225818294oxidized small RNAadult ovary
170GSM1584524225818294oxidized small RNAadult ovary
177GSM1584531325818294oxidized small RNAovary from 2nd trimester embryos
Location in hg19
27 best hit(s) with 0 mismatch(es) in hg19. RefSeq Gene RepeatMasker
Location 1chr15:30393335-30393365:-
Location 2chr15:30688286-30688316:+
Location 3chr15:30862332-30862362:-
Location 4chr15:32729635-32729665:+
Location 5chr15:102293668-102293698:+
Location 6chr15:102294012-102294042:+
Location 7chr15:102294538-102294568:+
Location 8chr15:102294973-102295003:+
Location 9chr15:102295499-102295529:+
Location 10chr15:102296025-102296055:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.
PubMed: 25818294
Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Cell Rep. 2015 Mar 31;10(12):2069-82.