piRNA



Detailed information of piRNA piR-hsa-13
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-13
Organism:Human
Sequence:GAAGAAGACACTCCTGGAGGAGTCGGC
Length:27
Accession:
Aliases:PIR192563 PIR192361 PIR192388 PIR192435 PIR192465 PIR192503 PIR192538 PIR192605 PIR192637 PIR192670 PIR192705 PIR192765 PIR192798 PIR192854 PIR192895 PIR192956 PIR193009 PIR193064 PIR193099 PIR193147 PIR193157
Number of Papers:2
Number of Methods:2
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
177GSM1584531325818294oxidized small RNAovary from 2nd trimester embryos
178GSM1584532125818294oxidized small RNAovary from 2nd trimester embryos
Location in hg38
21 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr15:101760991-101761018:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
No record.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.
PubMed: 25818294
Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Cell Rep. 2015 Mar 31;10(12):2069-82.