piRNA



Detailed information of piRNA piR-hsa-13
Go to: General Datasets Location Reference
General Information
Name:piR-hsa-13
Organism:Human
Sequence:GAAGAAGACACTCCTGGAGGAGTCGGC
Length:27
Accession:
Aliases:PIR192563 PIR192361 PIR192388 PIR192435 PIR192465 PIR192503 PIR192538 PIR192605 PIR192637 PIR192670 PIR192705 PIR192765 PIR192798 PIR192854 PIR192895 PIR192956 PIR193009 PIR193064 PIR193099 PIR193147 PIR193157
Number of Papers:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
Location in hg19
21 best hit(s) with 0 mismatch(es) in hg19. RefSeq Gene RepeatMasker
Location 1chr15:102293617-102293644:+
Location 2chr15:102293961-102293988:+
Location 3chr15:102294487-102294514:+
Location 4chr15:102294922-102294949:+
Location 5chr15:102295448-102295475:+
Location 6chr15:102295974-102296001:+
Location 7chr15:102296309-102296336:+
Location 8chr15:102296926-102296953:+
Location 9chr15:102297452-102297479:+
Location 10chr15:102297881-102297908:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.