piRNA



Detailed information of piRNA piR-hsa-12
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-12
Organism:Human
Sequence:TGGGAAGAAGAAGACACTCCTGGAGGAGTC
Length:30
Accession: DQ588479
Aliases:piR-55591 PIR192562 PIR192360 PIR192387 PIR192434 PIR192464 PIR192502 PIR192537 PIR192604 PIR192636 PIR192669 PIR192704 PIR192764 PIR192797 PIR192853 PIR192894 PIR192955 PIR193008 PIR193063 PIR193098 PIR193146 PIR193156 PIR49590
Number of Papers:3
Number of Methods:2
Datasets
DatasetAccessionReadsPubMedMethodTissue
1N/AN/A16751776small RNAtestis
2N/AN/A16751777small RNAtestis
176GSM1584530225818294small RNAovary from 2nd trimester embryos
177GSM15845312225818294oxidized small RNAovary from 2nd trimester embryos
178GSM1584532125818294oxidized small RNAovary from 2nd trimester embryos
Location in hg38
21 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr15:101756100-101756130:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
No record.
Reference
PubMed: 16751776
Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
A germline-specific class of small RNAs binds mammalian Piwi proteins
Nature. 2006 Jul 13;442(7099):199-202.
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.
PubMed: 25818294
Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Cell Rep. 2015 Mar 31;10(12):2069-82.