piRNA



Detailed information of piRNA piR-hsa-10
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-10
Organism:Human
Sequence:GTCGGCCGAGCAGGCACAGC
Length:20
Accession:
Aliases:PIR192560 PIR192358 PIR192385 PIR192463 PIR192668 PIR192702 PIR192762 PIR192851 PIR192953 PIR193006 PIR193096
Number of Papers:1
Number of Methods:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
Location in hg38
11 best hit(s) with 0 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr15:101761817-101761837:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
No record.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.