piRNA



Detailed information of piRNA piR-hsa-1
Go to: General Datasets Location Target Cancer Reference
General Information
Name:piR-hsa-1
Organism:Human
Sequence:AGAAGACATTCGTGGAGGCGTC
Length:22
Accession:
Aliases:PIR192551 PIR192868 PIR192285 PIR192296 PIR192306 PIR192318 PIR192327 PIR192337 PIR192349 PIR192376 PIR192403 PIR192412 PIR192424 PIR192446 PIR192456 PIR192480 PIR192493 PIR192515 PIR192528 PIR192578 PIR192595 PIR192614 PIR192627 PIR192649 PIR192659 PIR192681 PIR192693 PIR192723 PIR192743 PIR192753 PIR192788 PIR192811 PIR192842 PIR192885 PIR192914 PIR192934 PIR192944 PIR192979 PIR192997 PIR193023 PIR193035 PIR193046 PIR193052 PIR193077 PIR193087 PIR193114 PIR193124 PIR193136
Number of Papers:1
Number of Methods:1
Datasets
DatasetAccessionReadsPubMedMethodTissue
2N/AN/A16751777small RNAtestis
Location in hg38
48 best hit(s) with 1 mismatch(es) in hg38. RefSeq Gene RepeatMasker
Location 1chr15:101753169-101753191:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC.
Target mRNA
No record.
Target lncRNA
No record.
Cancer
No record.
Reference
PubMed: 16751777
Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
A novel class of small RNAs bind to MILI protein in mouse testes
Nature. 2006 Jul 13;442(7099):203-7.