piRNA Target lncRNAs

Function
Repeat & piRNA
Gene & piRNA
Target mRNAs
Target lncRNAs
Cancer & piRNA


Select organism
Gene Symbol
Trans ID
piRNA
  items per page
  Total page: 80  Total amount: 1199
first page | previous page | next page | last page
piRNA name piRNA sequence Target gene Target lncRNA Mechanism Target site Verified PubMed
piR-mmu-406380GTAAAAAAGAAAAAAAGAAAAGAAAGATGCAN/A NONMMUT000595 cleavagemm9 chr1:36973295-36973315:-n
piR-mmu-146311TGTGTTTGAATGCTTGGCCATAGGGAGTGT4930558J18RikNR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavagemm9 chr1:57416233-57416253:-n
piR-mmu-285378TGTGTTTGAATGCTTGGCCATAGGGAG4930558J18RikNR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavagemm9 chr1:57416233-57416253:-n
piR-mmu-188208TGTGTTTGAATGCTTGGCCATAGGGAGT4930558J18RikNR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavagemm9 chr1:57416233-57416253:-n
piR-mmu-285379TGTGTTTGAATGCTTGGCCATAGGGAGTGG4930558J18RikNR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavagemm9 chr1:57416233-57416253:-n
piR-mmu-568501TGTGTTTGAATGCTTGGCCATAGGGAGTGGT4930558J18RikNR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavagemm9 chr1:57416233-57416253:-n
piR-mmu-568500TGTGTTTGAATGCTTGGCCATAGGGAGTG4930558J18RikNR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavagemm9 chr1:57416233-57416253:-n
piR-mmu-568499TGTGTTTGAATGCTTGGCCATAGGGA4930558J18RikNR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavagemm9 chr1:57416233-57416253:-n
piR-mmu-568504TGTGTTTGAATGTTTGGCCTATAGGAAAT4930558J18RikNR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavagemm9 chr1:57416233-57416253:-n
piR-mmu-568505TGTGTTTGAATGTTTGGCCTATAGGAAATGGCAC4930558J18RikNR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavagemm9 chr1:57416233-57416253:-n
piR-mmu-370750CGATTGAGCGGCAAGCTCCACCCCTGAGCAAN/A NONMMUT001276 cleavagemm9 chr1:64624617-64624637:+n
piR-mmu-392483GAGGTCAGCCTGGGCTACATAGTGAGCTN/A NONMMUT001740 cleavagemm9 chr1:84737978-84737998:-n
piR-mmu-604706TTTAATCCTAGCACTGGGGAGTTTAGAGGCN/A NONMMUT002538 cleavagemm9 chr1:132619500-132619520:+n
piR-mmu-190766TTTAATCCTAGCACTCTGTAGGCAGAAGCAN/A NONMMUT002538 cleavagemm9 chr1:132619500-132619520:+n
piR-mmu-141907TAAAATCCTAGCACTCAGGAGGCTGAAGTAN/A NONMMUT002538 cleavagemm9 chr1:132619500-132619520:+n
  Total page: 80  Total amount: 1199
first page | previous page | next page | last page