Cancer related piRNAs

Function
Repeat & piRNA
Gene & piRNA
Target mRNAs
Target lncRNAs
Cancer & piRNA


Select cancer
  items per page
  Total page: 1  Total amount: 15
first page | previous page | next page | last page
PubMedNameSequenceID in articleCancerSubtypeExpression Function
23229900piR-hsa-24360TTCACTGATGAGAGCATTGTTCTGAGC piR-17458Breast cancerdown-regulated FC 2.04
23229900piR-hsa-28527GGTTCCATGGTGTAATGGTTAGCACTCTG piR-20582breast cancerup-regulated FC 3.24
23229900piR-hsa-28190GGCCGTGATCGTATAGTGGTTAGTACTCTG piR-20365breast cancerup-regulated FC 5.08
23229900piR-hsa-28374GGGGATGTAGCTCAGTGGTAGAGCGCATGCT piR-20485breast cancerup-regulated FC 5.12
23229900piR-hsa-27493GCATTGGTGGTTCAGTGGTAGAATTCTCAC piR-19825breast cancerup-regulated FC 6.52
23229900piR-hsa-7193TCGCCGTGATCGTATAGTGGTTAGTACTCTG piR-4987breast cancerup-regulated FC 7.46
23992744piR-hsa-1519AGGATGCTTGATCCTGAAGGGTTAGCAGCA piR-932Breast cancerCD44+/CD24−up-regulatedmay be a positive regulator through promoting the methylation of Latexin
25313140piR-hsa-1245AGCCCTGATGATGCCCACTCCTGAGC piR-31106Breast cancerup-regulated
25313140piR-hsa-26527GACCAATGATGAGATTGGAGGGTGTCTGAAT piR-34377Breast cancerdown-regulated
25313140piR-hsa-26872GAGGAATGATGACAAGAAAAGGCCGAA piR-34736Breast cancerdown-regulated
25313140piR-hsa-27616GCCCGGATGATCCTCAGTGGTCTGGGGTGC piR-35407Breast cancerdown-regulated
25313140piR-hsa-28175GGCCCCATGGTGTAATGGTCAGCACTC piR-36026Breast cancerup-regulated
25313140piR-hsa-28398GGGGGTATAGCTCAGTGGTAGAGCATTTGA piR-36249Breast cancerdown-regulated
25313140piR-hsa-28467GGTAGTGTGGCCGAGCGGTCTAAGGC piR-36318Breast cancerdown-regulated
25313140piR-hsa-28877GTTTCCGTAGTGTAGTGGTCATCACGTTCGCC piR-36743Breast cancerup-regulated
  Total page: 1  Total amount: 15
first page | previous page | next page | last page