Browse piRNAs in Dataset 9



PubMed: 16766680; Accession: N/A; Series: N/A; Uniq Seqs: 40
Organism: Mouse Method: small RNA; Type: N/A; Tissue: testis
  items per page
  Total page: 3  Total amount: 40
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-16712 DQ687473 Mouse TAGACAGCTTAGGACACTGAAAATTGTCTA 30 8N/A
piR-mmu-38144 DQ707557 Mouse TTATATGTTGGTTACTGAAGTACTTTCAGT 30 8N/A
piR-mmu-42513 DQ566619 DQ711621 Mouse TAGGAACATGACTGCTTTGTAAAGGGCCA 29 12N/A
piR-mmu-72688 Mouse GAATGAACTTGGCAGTACCCTCTAGATGA 29 2N/A
piR-mmu-72689 Mouse GAAGATCATAACCATCCTCATGTCTACAA 29 1N/A
piR-mmu-72690 Mouse GCCTTAAAGCTCAGAAACAATAAGGCCCA 29 1N/A
piR-mmu-72691 Mouse TTCTGCACAGTACTCTTATGCTCTGTG 27 3N/A
piR-mmu-72692 Mouse AGTCAGGAGGAGGGTTCAGCATGAAAGCCTGAC 33 1N/A
piR-mmu-72693 Mouse CGAGTGCGATGCTTTGTTTTAATTACACA 29 1N/A
piR-mmu-72694 Mouse TAAGTCAGAATCCCGCCCAGGCGGAAC 27 5N/A
piR-mmu-72695 Mouse GATTCCGTGGGTGGTGGTGCATGGTCGTTCTT 32 1N/A
piR-mmu-72696 Mouse CAGAAAGCCTGCCCTAGCATGGATGGTGAGC 31 2N/A
piR-mmu-72697 Mouse CAATATAGATGGATACGAATAAGGCGT 27 1N/A
piR-mmu-72698 Mouse ATAATAAGCTGATGGATGCTTGATCGTCA 29 2N/A
piR-mmu-72699 Mouse TTGGGTCATATTGAACTTTACTTGAATGTG 30 1N/A
  Total page: 3  Total amount: 40
first page | previous page | next page | last page
You can also Browse datasets or Browse piRNAs.