Browse piRNAs in Dataset 5

PubMed: 16751777; Accession: N/A; Series: N/A; Uniq Seqs: 3482
Organism: Mouse Method: MILI IP; Type: MILI; Tissue: testis
  items per page
  Total page: 233  Total amount: 3482
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1680 DQ551491 DQ685474 Mouse TGCTTTGCGGTTGCCTAAAAGCCATGGTC 29 6N/A
piR-mmu-1708 DQ551982 DQ703898 Mouse TAAAAACAGGTGTTTTGCTGCTGGCTCAG 29 7N/A
piR-mmu-2985 DQ551558 DQ691043 Mouse TGGAAAAGCTCACAGTCCTAACACACAGC 29 9N/A
piR-mmu-3044 DQ551611 DQ698921 Mouse TGGAAAGAAATGAAAATGAAATGTGCCA 28 9N/A
piR-mmu-3081 DQ551645 DQ720259 Mouse TGGAAAGTCCACGTTTTTTTGCCAACAGC 29 6N/A
piR-mmu-3312 DQ551870 DQ690911 Mouse TGGAAGGACTCAAATCATGGTGTCAGG 27 10N/A
piR-mmu-3560 DQ552125 DQ685252 Mouse TAAAACTTTAAAGAGCCCTCGAGTGTC 27 8N/A
piR-mmu-4843 DQ553234 DQ693752 Mouse TGGAGAAGAAAGGACACAGCCCGGCC 26 10N/A
  Total page: 233  Total amount: 3482
first page | previous page | next page | last page