Browse piRNAs in Dataset 4




PubMed: 16751776; Accession: N/A; Series: N/A; Uniq Seqs: 30013
Organism: Mouse Method: small RNA; Type: MIWI; Tissue: testis
  items per page
  Total page: 2001  Total amount: 30013
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1 DQ539889 DQ715868 Mouse TGACATGAACACAGGTGCTCAGATAGCTTT 30 11N/A
piR-mmu-2 DQ548889 Mouse TGCAAGGTACTAGATTGGATGCCCTGA 27 1N/A
piR-mmu-3 DQ548890 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGG 29 3N/A
piR-mmu-4 DQ548891 DQ710002 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGGC 30 6N/A
piR-mmu-5 DQ548892 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGGCC 31 3N/A
piR-mmu-6 DQ548893 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGGT 30 2N/A
piR-mmu-7 DQ548894 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGGTT 31 2N/A
piR-mmu-8 DQ548895 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGT 27 1N/A
piR-mmu-9 DQ548896 Mouse TGCAAGGTGATTACTTGAAACTCAACTTGA 30 5N/A
piR-mmu-10 DQ548897 Mouse TGCAAGGTGCCACAAAAGGTATTTACAGG 29 1N/A
piR-mmu-11 DQ548898 Mouse TGCAAGGTGCCACCAAAAGGTATTTACAGG 30 2N/A
piR-mmu-12 DQ539890 DQ720996 Mouse TGTGTGATGCATACGACGGTGTCTGCTGGT 30 5N/A
piR-mmu-13 DQ548899 Mouse TGCAAGGTGGATGATATACCCCAACAGGCC 30 1N/A
piR-mmu-14 DQ548900 Mouse TGCAAGGTGGTCAGACAATTTTGTCAGAACTG 32 1N/A
piR-mmu-15 DQ548901 Mouse TGCAAGGTGTCTTATGGATTTGAAGTGT 28 1N/A
  Total page: 2001  Total amount: 30013
first page | previous page | next page | last page