Browse piRNAs in Dataset 14




PubMed: 22121019; Accession: GSM822761; Series: GSE32184; Uniq Seqs: 999408
Organism: Mouse Method: Miwi IP; Type: MIWI; Tissue: Testes, C57BL/6 Adult Miwi +/ADH
  items per page
  Total page: 66628  Total amount: 999408
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1 DQ539889 DQ715868 Mouse TGACATGAACACAGGTGCTCAGATAGCTTT 30 118573
piR-mmu-3 DQ548890 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGG 29 38
piR-mmu-9 DQ548896 Mouse TGCAAGGTGATTACTTGAAACTCAACTTGA 30 51
piR-mmu-12 DQ539890 DQ720996 Mouse TGTGTGATGCATACGACGGTGTCTGCTGGT 30 543
piR-mmu-23 DQ539891 Mouse TGAGAGTGGCATCTAAATGTTTAGTGGT 28 85
piR-mmu-24 DQ548909 DQ697982 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGG 29 519
piR-mmu-25 DQ548910 DQ694780 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGGT 30 524
piR-mmu-28 DQ548913 Mouse TGCAAGTATACCTGATTGTCAGGAGCCATC 30 48
piR-mmu-29 DQ548914 Mouse TGCAAGTATGATCCTGAACTGGATGCCAGAT 31 4157
piR-mmu-31 DQ548916 Mouse TGCAAGTCAGGTGTCTTCCTCTATTGTCC 29 21
piR-mmu-38 DQ548922 DQ719861 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGA 29 768
piR-mmu-39 DQ548923 DQ689483 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGAT 30 628
piR-mmu-42 DQ548926 Mouse TGCAAGTGCTCTTAAGAAGGATAATCCCAG 30 21
piR-mmu-43 DQ548927 Mouse TGCAAGTGCTGTATCTTTATCAAAACCCAGG 31 42
piR-mmu-45 DQ539893 Mouse AAAAAAAAACACAAGGATTTGATTGCCAAG 30 33
  Total page: 66628  Total amount: 999408
first page | previous page | next page | last page