Browse piRNAs in Dataset 9

PubMed: 16766680; Accession: N/A; Series: N/A; Uniq Seqs: 40
Organism: Mouse Method: small RNA; Type: N/A; Tissue: testis
  items per page
  Total page: 3  Total amount: 40
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-42513 DQ566619 DQ711621 Mouse TAGGAACATGACTGCTTTGTAAAGGGCCA 29 12N/A
  Total page: 3  Total amount: 40
first page | previous page | next page | last page