Browse piRNAs in Dataset 8




PubMed: 16778019; Accession: GSM113418; Series: GSE5026; Uniq Seqs: 40670
Organism: Rat Method: Chromatography; Type: RIWI; Tissue: testis tissue from Sprague-Dawley male rats, 7-8 weeks old
  items per page
  Total page: 2712  Total amount: 40670
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-rno-1 DQ730146 Rat TGGAACATTCAGCAATTTCCTTGCCTCTC 29 21
piR-rno-2 DQ730147 Rat TAGAAAATGAATTTCAACAGAGATGGC 27 26
piR-rno-3 DQ730148 Rat TCTTAGTGTGTATGCCTTGCTGCTAT 26 11
piR-rno-4 DQ730149 Rat TGTAGCAGTGAACTACAGGGTCTTT 25 11
piR-rno-5 DQ730150 Rat TCCACAAACAAATTGTCTCTGCTTAAAC 28 21
piR-rno-6 DQ730151 Rat TTCCTTTTCAATGGGCTTTGGTGTCCTCGC 30 21
piR-rno-7 DQ730152 Rat TAGGTGCCAGGTAAAGAGAGACCCT 25 11
piR-rno-8 DQ730153 Rat TTGTTAAGATTTGCTTCTCTGGTTGA 26 21
piR-rno-9 DQ730154 Rat TCGATATGATGGCACTACAAGCTCTGCAC 29 23
piR-rno-10 DQ730155 DQ621365 Rat TTTGAAGAAAGGTCAGAAGCTCAATGGCGC 30 313
piR-rno-11 DQ730156 DQ606566 Rat TGAAACAGCATACCGCATGACAGGGAAGG 29 31
piR-rno-12 DQ730157 Rat TGCCAGTGACTGTGTGCTTACCTTCT 26 22
piR-rno-13 DQ730158 Rat TGGGCCTCTGAGAGAACACTGTCCCC 26 21
piR-rno-14 DQ730159 Rat TGGAAAGATGGGCTACTTTGTGTCATT 27 11
piR-rno-15 DQ730160 Rat TGCATTTAAGTGCGCCGTGCGATATAG 27 11
  Total page: 2712  Total amount: 40670
first page | previous page | next page | last page