Browse piRNAs in Dataset 7




PubMed: 16751776; Accession: N/A; Series: N/A; Uniq Seqs: 26567
Organism: Rat Method: small RNA; Type: RIWI; Tissue: testis
  items per page
  Total page: 1772  Total amount: 26567
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-rno-10 DQ730155 DQ621365 Rat TTTGAAGAAAGGTCAGAAGCTCAATGGCGC 30 3N/A
piR-rno-11 DQ730156 DQ606566 Rat TGAAACAGCATACCGCATGACAGGGAAGG 29 3N/A
piR-rno-20 DQ730165 DQ614945 Rat TAAATACAGTTACTGTTGCCACAATCCCAGT 31 3N/A
piR-rno-28 DQ730173 DQ617721 Rat TGTGATAAATGCCGTGTGTGCTTGGACCA 29 2N/A
piR-rno-30 DQ730175 DQ617446 Rat TGTCTGTCGAGTAGACCTCATCCCAACATA 30 3N/A
piR-rno-33 DQ730178 DQ616796 Rat TGTAAAATGAATTAGCAATGCCAAGAG 27 3N/A
piR-rno-38 DQ730183 DQ620876 Rat TTGGATCTTAGATCGATGCAGCCATTGT 28 3N/A
piR-rno-42 DQ730187 DQ613342 Rat TGGCAACGTGCAAGAGATGGTGATCCAGGT 30 3N/A
piR-rno-46 DQ727433 DQ608081 Rat TGACTTTTCATTTTGTTGCCTGTTAAGTC 29 3N/A
piR-rno-47 DQ727434 DQ625239 Rat TAGGATGGTGTTCTTGATAGTTCAGATCGC 30 3N/A
piR-rno-65 DQ727647 DQ624114 Rat TAGAACACGTTTTTCCACATGTTTTCTTGC 30 3N/A
piR-rno-68 DQ727650 DQ625621 Rat TAGGTTGCTAAGCTATTCCTGTGCCTGTC 29 2N/A
piR-rno-69 DQ727651 DQ613956 Rat TGGCTTGAGCATTTGAAATCCCAAAGCC 28 2N/A
piR-rno-76 DQ727404 DQ622693 Rat TACAAAGTGAGTTTGAGGATAGCCTGGGC 29 3N/A
piR-rno-83 DQ727411 DQ605475 Rat TCTACCTGAAACTGAAACTGTTTGGTGGA 29 3N/A
  Total page: 1772  Total amount: 26567
first page | previous page | next page | last page