Browse piRNAs in Dataset 6




PubMed: 16778019; Accession: GSM113695; Series: GSE5026; Uniq Seqs: 43306
Organism: Mouse Method: Chromatography; Type: MIWI; Tissue: testes tissue from Swiss Webster male mice, 8-10 weeks old
  items per page
  Total page: 2888  Total amount: 43306
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1 DQ539889 DQ715868 Mouse TGACATGAACACAGGTGCTCAGATAGCTTT 30 1455
piR-mmu-4 DQ548891 DQ710002 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGGC 30 92
piR-mmu-12 DQ539890 DQ720996 Mouse TGTGTGATGCATACGACGGTGTCTGCTGGT 30 81
piR-mmu-16 DQ548902 DQ686373 Mouse TGCAAGGTGTCTTATGGGATTTGAAGT 27 81
piR-mmu-24 DQ548909 DQ697982 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGG 29 71
piR-mmu-25 DQ548910 DQ694780 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGGT 30 81
piR-mmu-38 DQ548922 DQ719861 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGA 29 109
piR-mmu-39 DQ548923 DQ689483 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGAT 30 95
piR-mmu-65 DQ548947 DQ694361 Mouse TGCAATAGGGAAGTCTATTTGGGGTGTTT 29 82
piR-mmu-76 DQ548957 DQ697969 Mouse TGCAATATTGGCCTTTGTTCAGGGTTTACA 30 82
piR-mmu-77 DQ548958 DQ725592 Mouse TGCAATATTGGCCTTTGTTCAGGGTTTACAC 31 83
piR-mmu-79 DQ548959 DQ707257 Mouse TGCAATATTGGCCTTTGTTCAGGGTTTACACA 32 62
piR-mmu-87 DQ548967 DQ699303 Mouse TGCAATCTATTGGAGAGAAAGTTTCAGTTG 30 62
piR-mmu-88 DQ548968 DQ723466 Mouse TGCAATCTATTGGAGAGAAAGTTTCAGTTGC 31 71
piR-mmu-101 DQ548979 DQ685999 Mouse TGCAATGAAGGTGATGTTCTTTTTGGCGTC 30 87
  Total page: 2888  Total amount: 43306
first page | previous page | next page | last page