Browse piRNAs in Dataset 3




PubMed: 22313525; Accession: N/A; Series: N/A; Uniq Seqs: 991
Organism: Human Method: small RNA; Type: N/A; Tissue: epididymis
  items per page
  Total page: 67  Total amount: 991
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-hsa-9 DQ588378 Human TGGGAACGAGAAGACACTCATGGAGGAGTC 30 310
piR-hsa-15 DQ578298 Human TCTTCTCGGAGCTGCTGTCCAACCTGTAC 29 36
piR-hsa-17 DQ576941 Human TCGGAACCTGCAGACACTTGTGGAGGAGT 29 31
piR-hsa-21 DQ588408 Human TGGGAACGAGAAGACACTCGTGGAGGCG 28 315
piR-hsa-22 DQ588410 Human TGGGAACGAGAAGACACTCGTGGAGGCGTC 30 379
piR-hsa-28 DQ588329 Human TGGGAACAAGAAGACACTCGTGGAGGCGTC 30 335
piR-hsa-36 DQ588360 Human TGGGAACCAGAAGACACTCGTGGAGGCGTC 30 3307
piR-hsa-40 DQ588388 Human TGGGAACGAGAAGACACTCCTGGAGGAGTC 30 32
piR-hsa-42 DQ601652 Human TAGGGACAAGAAGACACTCCTGGAGGAGTC 30 35
piR-hsa-65 Human TGAATTAGCAAAACTGACTGGTAGGC 26 21
piR-hsa-101 DQ598558 Human GTGGAAGTGACAGGAGCTCAGCATCCCTGT 30 32
piR-hsa-103 DQ588635 Human TGGGACAGGTAACACAGGCTTTAGGCTGGC 30 32
piR-hsa-395 DQ570086 Human AAGACTTAGAGATGGAAAGTAGTTCAATGG 30 21
piR-hsa-522 DQ570213 Human AATTGGATCACACATGGGCTTGGAGA 26 21
piR-hsa-608 DQ570299 Human ACAGAACCTCATGGTACGGAACCACCAGG 29 21
  Total page: 67  Total amount: 991
first page | previous page | next page | last page