Browse piRNAs in Dataset 2



PubMed: 16751777; Accession: N/A; Series: N/A; Uniq Seqs: 148
Organism: Human Method: small RNA; Type: HILI; Tissue: testis
  items per page
  Total page: 10  Total amount: 148
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-hsa-1 Human AGAAGACATTCGTGGAGGCGTC 22 1N/A
piR-hsa-2 Human ACGCCTCCACGTAGTGTCTT 20 1N/A
piR-hsa-3 Human ACGCCTCCACGAGTGTCTT 19 1N/A
piR-hsa-4 Human ACCAAGGACTTCATCTTCTCAGAGCTGCTGT 31 1N/A
piR-hsa-5 DQ573815 Human TCATCTTCTCAGAGCTGCTGTCCAACCTGC 30 3N/A
piR-hsa-6 Human TGTCCAACCTGCACTCGCGTGGGAA 25 2N/A
piR-hsa-7 Human TGGAAACGAGAAGACACTCATGGAGGAGT 29 1N/A
piR-hsa-8 Human TGGGAACGAGAAGACACTCATGGAGGCGTC 30 1N/A
piR-hsa-9 DQ588378 Human TGGGAACGAGAAGACACTCATGGAGGAGTC 30 4N/A
piR-hsa-10 Human GTCGGCCGAGCAGGCACAGC 20 1N/A
piR-hsa-11 Human TCGCGNGGGAAGAAGAAGACACTCCT 26 1N/A
piR-hsa-12 DQ588479 Human TGGGAAGAAGAAGACACTCCTGGAGGAGTC 30 3N/A
piR-hsa-13 Human GAAGAAGACACTCCTGGAGGAGTCGGC 27 2N/A
piR-hsa-14 DQ578299 Human TCTTCTCGGAGCTGCTGTCCAACCTGTACT 30 3N/A
piR-hsa-15 DQ578298 Human TCTTCTCGGAGCTGCTGTCCAACCTGTAC 29 4N/A
  Total page: 10  Total amount: 148
first page | previous page | next page | last page
You can also Browse datasets or Browse piRNAs.