Browse piRNAs in Dataset 167



PubMed: 25818294; Accession: GSM1584521; Series: GSE64942; Uniq Seqs: 162582
Organism: Human Method: small RNA; Type: N/A; Tissue: adult ovary
  items per page
  Total page: 10839  Total amount: 162582
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-hsa-15 DQ578298 Human TCTTCTCGGAGCTGCTGTCCAACCTGTAC 29 41
piR-hsa-16 DQ578300 Human TCTTCTCGGAGCTGCTGTCCAACCTGTACTC 31 31
piR-hsa-325 DQ570001 Human AAATGTTGGTTATACCCTTCCCGTACTACC 30 21
piR-hsa-1207 DQ570956 Human AGCATTGGTGGTTCAGTGGTAGAATTCTCGC 31 27
piR-hsa-1245 DQ570994 Human AGCCCTGATGATGCCCACTCCTGAGC 26 32
piR-hsa-1254 DQ571003 Human AGCCTGAGCAACATAGCGAGACCCCGTCTCTA 32 234
piR-hsa-1281 DQ571030 Human AGCGTTGGTGGTATAGTGGTGAGCATAGC 29 21
piR-hsa-3909 DQ573630 Human TCAGGGGTGTTCTTACCCTCAGCAGTTGGGT 31 22
piR-hsa-5936 DQ575658 Human TCCCTGGTGGTCTAGTGGTTAGGATA 26 26
piR-hsa-5937 DQ575659 Human TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA 31 265
piR-hsa-5938 DQ575660 Human TCCCTGGTGGTCTAGTGGTTAGGATTCGGCAC 32 266
piR-hsa-6024 DQ575746 Human TCCGAGATGATGAACTCCGGGGTCTGAGAGT 31 21
piR-hsa-6146 DQ575883 Human TCCGTAGTGTAGTGGTTATCACGTTCGCCTG 31 231
piR-hsa-6147 DQ575884 Human TCCGTAGTGTAGTGGTTATCACGTTCGCCTGA 32 27
piR-hsa-6148 DQ575885 Human TCCGTAGTGTAGTGGTTATCACTTTCGCCT 30 27
  Total page: 10839  Total amount: 162582
first page | previous page | next page | last page
You can also Browse datasets or Browse piRNAs.