Browse piRNAs in Dataset 15




PubMed: 22121019; Accession: GSM822762; Series: GSE32184; Uniq Seqs: 551640
Organism: Mouse Method: Miwi IP; Type: MIWI; Tissue: Testes, C57BL/6 Adult Miwi -/ADH
  items per page
  Total page: 36776  Total amount: 551640
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1 DQ539889 DQ715868 Mouse TGACATGAACACAGGTGCTCAGATAGCTTT 30 1428
piR-mmu-12 DQ539890 DQ720996 Mouse TGTGTGATGCATACGACGGTGTCTGCTGGT 30 86
piR-mmu-22 DQ548908 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGG 28 61
piR-mmu-23 DQ539891 Mouse TGAGAGTGGCATCTAAATGTTTAGTGGT 28 112
piR-mmu-24 DQ548909 DQ697982 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGG 29 74
piR-mmu-25 DQ548910 DQ694780 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGGT 30 82
piR-mmu-29 DQ548914 Mouse TGCAAGTATGATCCTGAACTGGATGCCAGAT 31 727
piR-mmu-38 DQ548922 DQ719861 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGA 29 102
piR-mmu-45 DQ539893 Mouse AAAAAAAAACACAAGGATTTGATTGCCAAG 30 52
piR-mmu-52 DQ548935 Mouse TGCAAGTGTTCGGGTTGCTGACTGCAGA 28 146
piR-mmu-59 DQ548941 Mouse TGCAAGTTGCTGGCTGTCGGATCTTAAA 28 511
piR-mmu-76 DQ548957 DQ697969 Mouse TGCAATATTGGCCTTTGTTCAGGGTTTACA 30 82
piR-mmu-77 DQ548958 DQ725592 Mouse TGCAATATTGGCCTTTGTTCAGGGTTTACAC 31 86
piR-mmu-79 DQ548959 DQ707257 Mouse TGCAATATTGGCCTTTGTTCAGGGTTTACACA 32 64
piR-mmu-96 DQ548975 Mouse TGCAATCTTTCTATGTGTCTCATGGAACTC 30 81
  Total page: 36776  Total amount: 551640
first page | previous page | next page | last page