Browse piRNAs in Dataset 14

PubMed: 22121019; Accession: GSM822761; Series: GSE32184; Uniq Seqs: 999408
Organism: Mouse Method: Miwi IP; Type: MIWI; Tissue: Testes, C57BL/6 Adult Miwi +/ADH
  items per page
  Total page: 66628  Total amount: 999408
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1 DQ539889 DQ715868 Mouse TGACATGAACACAGGTGCTCAGATAGCTTT 30 148573
piR-mmu-12 DQ539890 DQ720996 Mouse TGTGTGATGCATACGACGGTGTCTGCTGGT 30 843
piR-mmu-24 DQ548909 DQ697982 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGG 29 719
piR-mmu-25 DQ548910 DQ694780 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGGT 30 824
piR-mmu-38 DQ548922 DQ719861 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGA 29 1068
piR-mmu-39 DQ548923 DQ689483 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGAT 30 928
  Total page: 66628  Total amount: 999408
first page | previous page | next page | last page