Browse piRNAs in Dataset 13

PubMed: 22121019; Accession: GSM822759; Series: GSE32184; Uniq Seqs: 575786
Organism: Mouse Method: Miwi IP; Type: MIWI; Tissue: Testes, C57BL/6 P20 Miwi +/+
  items per page
  Total page: 38386  Total amount: 575786
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1 DQ539889 DQ715868 Mouse TGACATGAACACAGGTGCTCAGATAGCTTT 30 1416731
piR-mmu-12 DQ539890 DQ720996 Mouse TGTGTGATGCATACGACGGTGTCTGCTGGT 30 8118
piR-mmu-24 DQ548909 DQ697982 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGG 29 716
piR-mmu-25 DQ548910 DQ694780 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGGT 30 830
piR-mmu-38 DQ548922 DQ719861 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGA 29 10165
piR-mmu-39 DQ548923 DQ689483 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGAT 30 933
  Total page: 38386  Total amount: 575786
first page | previous page | next page | last page
You can also Browse datasets or Browse piRNAs.