Browse piRNAs in Dataset 13




PubMed: 22121019; Accession: GSM822759; Series: GSE32184; Uniq Seqs: 575786
Organism: Mouse Method: Miwi IP; Type: MIWI; Tissue: Testes, C57BL/6 P20 Miwi +/+
  items per page
  Total page: 38386  Total amount: 575786
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1 DQ539889 DQ715868 Mouse TGACATGAACACAGGTGCTCAGATAGCTTT 30 1116731
piR-mmu-3 DQ548890 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGG 29 322
piR-mmu-9 DQ548896 Mouse TGCAAGGTGATTACTTGAAACTCAACTTGA 30 53
piR-mmu-12 DQ539890 DQ720996 Mouse TGTGTGATGCATACGACGGTGTCTGCTGGT 30 5118
piR-mmu-23 DQ539891 Mouse TGAGAGTGGCATCTAAATGTTTAGTGGT 28 83
piR-mmu-24 DQ548909 DQ697982 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGG 29 516
piR-mmu-25 DQ548910 DQ694780 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGGT 30 530
piR-mmu-28 DQ548913 Mouse TGCAAGTATACCTGATTGTCAGGAGCCATC 30 48
piR-mmu-29 DQ548914 Mouse TGCAAGTATGATCCTGAACTGGATGCCAGAT 31 4115
piR-mmu-35 DQ548919 Mouse TGCAAGTGAGTGCCTGTGATGGCCCTTGTC 30 21
piR-mmu-38 DQ548922 DQ719861 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGA 29 7165
piR-mmu-39 DQ548923 DQ689483 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGAT 30 633
piR-mmu-42 DQ548926 Mouse TGCAAGTGCTCTTAAGAAGGATAATCCCAG 30 21
piR-mmu-45 DQ539893 Mouse AAAAAAAAACACAAGGATTTGATTGCCAAG 30 33
piR-mmu-51 DQ548934 Mouse TGCAAGTGTTCGGGTTGCTGACTGCAG 27 76
  Total page: 38386  Total amount: 575786
first page | previous page | next page | last page