Browse piRNAs in Dataset 12




PubMed: 22121019; Accession: GSM822758; Series: GSE32184; Uniq Seqs: 720903
Organism: Mouse Method: Miwi IP; Type: MIWI; Tissue: Testes, C57BL/6 P14 Miwi +/+
  items per page
  Total page: 48061  Total amount: 720903
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1 DQ539889 DQ715868 Mouse TGACATGAACACAGGTGCTCAGATAGCTTT 30 117945
piR-mmu-3 DQ548890 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGG 29 320
piR-mmu-9 DQ548896 Mouse TGCAAGGTGATTACTTGAAACTCAACTTGA 30 51
piR-mmu-12 DQ539890 DQ720996 Mouse TGTGTGATGCATACGACGGTGTCTGCTGGT 30 586
piR-mmu-23 DQ539891 Mouse TGAGAGTGGCATCTAAATGTTTAGTGGT 28 84
piR-mmu-24 DQ548909 DQ697982 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGG 29 543
piR-mmu-25 DQ548910 DQ694780 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGGT 30 545
piR-mmu-28 DQ548913 Mouse TGCAAGTATACCTGATTGTCAGGAGCCATC 30 47
piR-mmu-29 DQ548914 Mouse TGCAAGTATGATCCTGAACTGGATGCCAGAT 31 4107
piR-mmu-38 DQ548922 DQ719861 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGA 29 7121
piR-mmu-39 DQ548923 DQ689483 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGAT 30 639
piR-mmu-42 DQ548926 Mouse TGCAAGTGCTCTTAAGAAGGATAATCCCAG 30 23
piR-mmu-45 DQ539893 Mouse AAAAAAAAACACAAGGATTTGATTGCCAAG 30 31
piR-mmu-51 DQ548934 Mouse TGCAAGTGTTCGGGTTGCTGACTGCAG 27 72
piR-mmu-52 DQ548935 Mouse TGCAAGTGTTCGGGTTGCTGACTGCAGA 28 1143
  Total page: 48061  Total amount: 720903
first page | previous page | next page | last page