Browse piRNAs in Dataset 11




PubMed: 22121019; Accession: GSM822760; Series: GSE32184; Uniq Seqs: 568759
Organism: Mouse Method: Miwi IP; Type: MIWI; Tissue: Testes, C57BL/6 Adult Miwi +/+
  items per page
  Total page: 37918  Total amount: 568759
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-1 DQ539889 DQ715868 Mouse TGACATGAACACAGGTGCTCAGATAGCTTT 30 1415564
piR-mmu-3 DQ548890 Mouse TGCAAGGTCGCAAGGTCGCAAGGTCGAGG 29 65
piR-mmu-9 DQ548896 Mouse TGCAAGGTGATTACTTGAAACTCAACTTGA 30 74
piR-mmu-12 DQ539890 DQ720996 Mouse TGTGTGATGCATACGACGGTGTCTGCTGGT 30 8101
piR-mmu-23 DQ539891 Mouse TGAGAGTGGCATCTAAATGTTTAGTGGT 28 114
piR-mmu-24 DQ548909 DQ697982 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGG 29 728
piR-mmu-25 DQ548910 DQ694780 Mouse TGCAAGGTTACTTTTCAGGGTGTGTCGGGT 30 842
piR-mmu-28 DQ548913 Mouse TGCAAGTATACCTGATTGTCAGGAGCCATC 30 76
piR-mmu-29 DQ548914 Mouse TGCAAGTATGATCCTGAACTGGATGCCAGAT 31 7170
piR-mmu-31 DQ548916 Mouse TGCAAGTCAGGTGTCTTCCTCTATTGTCC 29 51
piR-mmu-38 DQ548922 DQ719861 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGA 29 10113
piR-mmu-39 DQ548923 DQ689483 Mouse TGCAAGTGCGCTGACTTCCATTGGCACGAT 30 917
piR-mmu-43 DQ548927 Mouse TGCAAGTGCTGTATCTTTATCAAAACCCAGG 31 71
piR-mmu-45 DQ539893 Mouse AAAAAAAAACACAAGGATTTGATTGCCAAG 30 53
piR-mmu-51 DQ548934 Mouse TGCAAGTGTTCGGGTTGCTGACTGCAG 27 92
  Total page: 37918  Total amount: 568759
first page | previous page | next page | last page