Browse piRNAs in Dataset 10

PubMed: 16766680; Accession: N/A; Series: N/A; Uniq Seqs: 367
Organism: Mouse Method: small RNA; Type: gsRNA; Tissue: testis
  items per page
  Total page: 25  Total amount: 367
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-mmu-568 DQ549317 AB251278 Mouse TGCAGTACGGAGAGAGGGATGCTGG 25 11N/A
piR-mmu-6178 DQ554508 DQ685571 AB250988 Mouse TGGGAAGCTTGTTGAGTTAGAGTGTCTCTC 30 9N/A
piR-mmu-6342 DQ554657 DQ719893 AB251216 Mouse TGGGAGAACTAAAAAAGAAAGGTGCTGGG 29 13N/A
piR-mmu-6363 DQ554676 AB251128 Mouse TGGGAGAATTTAGAAAGGCAAGGTGCAGG 29 8N/A
piR-mmu-9622 DQ557579 DQ690496 AB251233 Mouse TGTGATGAAGGTTGATAAGTGCTTGG 26 12N/A
piR-mmu-9995 AB251157 Mouse CTAGAGGCTTGGAAATGAC 19 3N/A
piR-mmu-10393 AB251262 Mouse TAAGAGATGATTTTGGAAGAGAGAA 25 11N/A
piR-mmu-10429 DQ568597 DQ687893 AB251109 Mouse TATTGAGAAGGATGCCGATTCTATGTCATC 30 11N/A
piR-mmu-10541 DQ693064 AB251171 Mouse TAGCAGGATGTTTTTGGATTCAGGT 25 12N/A
piR-mmu-11029 AB251135 Mouse TTGTAGACATGAGGATGGTTATGATC 26 14N/A
piR-mmu-11043 AB251136 Mouse TCCATGTGTGGATTCAGGAAGC 22 4N/A
piR-mmu-11461 DQ721530 AB251284 Mouse TGCAATACATGGAAACAGCCAGTTAGC 27 12N/A
piR-mmu-11788 AB251287 Mouse TGGCATTGAGTGAGGAGAGAGATGG 25 11N/A
piR-mmu-13454 DQ714223 AB251322 Mouse TGATTAGATGAATATGGTGATGTGGC 26 18N/A
  Total page: 25  Total amount: 367
first page | previous page | next page | last page