Browse piRNAs in Dataset 1




PubMed: 16751776; Accession: N/A; Series: N/A; Uniq Seqs: 32046
Organism: Human Method: small RNA; Type: HIWI; Tissue: testis
  items per page
  Total page: 2137  Total amount: 32046
first page | previous page | next page | last page
Name Accession Organism Sequence Length Papers Reads
piR-hsa-5 DQ573815 Human TCATCTTCTCAGAGCTGCTGTCCAACCTGC 30 2N/A
piR-hsa-9 DQ588378 Human TGGGAACGAGAAGACACTCATGGAGGAGTC 30 3N/A
piR-hsa-12 DQ588479 Human TGGGAAGAAGAAGACACTCCTGGAGGAGTC 30 2N/A
piR-hsa-14 DQ578299 Human TCTTCTCGGAGCTGCTGTCCAACCTGTACT 30 2N/A
piR-hsa-15 DQ578298 Human TCTTCTCGGAGCTGCTGTCCAACCTGTAC 29 3N/A
piR-hsa-16 DQ578300 Human TCTTCTCGGAGCTGCTGTCCAACCTGTACTC 31 2N/A
piR-hsa-17 DQ576941 Human TCGGAACCTGCAGACACTTGTGGAGGAGT 29 3N/A
piR-hsa-18 DQ576942 Human TCGGAACCTGCAGACACTTGTGGAGGAGTC 30 2N/A
piR-hsa-21 DQ588408 Human TGGGAACGAGAAGACACTCGTGGAGGCG 28 3N/A
piR-hsa-22 DQ588410 Human TGGGAACGAGAAGACACTCGTGGAGGCGTC 30 3N/A
piR-hsa-24 DQ588417 Human TGGGAACGAGAAGACACTCGTGTAGGCGTC 30 2N/A
piR-hsa-28 DQ588329 Human TGGGAACAAGAAGACACTCGTGGAGGCGTC 30 3N/A
piR-hsa-32 DQ591415 Human TGTGACGAGACTCGCGTGGGAAGAAGAAG 29 2N/A
piR-hsa-34 DQ588582 Human TGGGAATGAGAAGACACTCGTGAAGGCGTC 30 2N/A
piR-hsa-35 DQ588387 Human TGGGAACGAGAAGACACTCATGTAGGAGTC 30 2N/A
  Total page: 2137  Total amount: 32046
first page | previous page | next page | last page